L and DNAse remedy (DNA-free, Ambion) RNA was re-precipitated with 3 M sodium acetate (pH 5.5, Ambion) and dissolved in molecular biology grade water (25 for surface cells, 50 for deep cells). RNA with A260 /A280 and A260 /A230 ratios of 1.8 was deemed excellent good quality. RNA (1.7?53.three ng for the surface zone; 108.eight?864.9 ng for the deep zone) was primed with random hexadeoxynucleotides (Promega, Southampton, UK) and reverse transcribed based on manufacturer’s directions (Superscript III, Invitrogen). Gene expression of E11, osteocalcin (OCN), runt-related transcription element 2 (Runx2), variety I collagen (Col1a1), ALP, and simian vacuolating virus 40 (SV40) big T-antigen had been analyzed by RTqPCR [SYBR Green I master mix (Sigma), 2.5 mM MgCl2 , 200 nM each and every primer, Stratagene MX3000P]. All targets except OCN applied intron-spanning primers (Table 1) and no template controls werewww.frontiersin.orgDecember 2014 Volume five Article 208 Vazquez et al.Osteocyte steoblast co-culture modelTable 1 Primer details. Gene Primers (5 ? ) Amplicon size (bp) GAPDH (human) Fwd ?GGT ATC GTG GAA GGA CTC ATG A NM_002046.5 HPRT1 (human) NM_000194.2 18S rRNA NR_003278.three E11 (human) NM_006474.four RUNX2 (human) NM_ 001024630.three COL1A1 (human) Fwd ?CAG CCG CTT CAC CTA CAG C NM_000088.3 OCN (human) NM_199173.four Gapdh (mouse) NM_ 001289726.1 Hprt (mouse) NM_013556.two E11 (mouse) NM_010329.3 Runx2 (mouse) NM_ 001146038.2 Col1a1 (mouse) NM_007742.3 OCN (mouse) NM_007541.three ALP (mouse) NM_ 001287172.1 SV40 Fwd ?AGGGGGAGGTGTGGGAGGTTTT 100 Fwd ?ACT GCC CTC CTG ACG CAT GG Rev ?TCG CAC ACA GCC GTG CCA TT Fwd ?CCGCCTACAAACGCATCTAT Rev ?TTTTGGAGCTGCTGTGACAT Fwd ?GCTGGCCCTTGACCCCTCCA Rev ?ATCCGGAGGGCCACCTCCAC 132 153 140 Fwd ?CGTGATTAGCGATGATGAACCAGGT Rev ?CCATCTCCTTCATGACATCTCGAGC Fwd ?AAG ATG GCT TGC CAG TAG TCA Rev ?GGC GAG AAC CTT CCA GAA AT Fwd ?GAC GAG GCA AGA GTT TCA CC Rev ?GTC TGT GCC TTC TTG GTT CC 120 118 149 Rev ?TTT TGT ATT CAA TCA CTG TCT TGC C Fwd ?GGC AGC GAG GTA GTG AAG AG Rev ?GAT CCG GGT AGG GGA CTG Fwd ?GAC GGC CGC ATC TTC TTG TGC A Rev ?TGC AAA TGG CAG CCC TGG TGA C 114 73 83 Rev ?GGC CAT CCA CAG TCT TCT G Fwd ?GCA GAC TTT GCT TTC CTT GG Rev ?GTG GGG TCC TTT TCA CCA G Fwd ?GCA ATT ATT CCC CAT GAA CG Rev ?GGC CTC ACT AAA CCA TCC AA Fwd ?ACG GAG AAA GTG GAT GGA GA Rev ?ACG ATG ATT GCA CCA ATG AA Fwd ?GTG GAC GAG GCA AGA GTT TC Rev ?TTC CCG AGG TCC ATC TAC TG 107 186 125 80genes (RG), 18S rRNA, glyceraldehyde 3-phosphate dehydrogenase (GAPDH ), and hypoxanthine uanine phosphoribosyltransferase (HPRT1). The most steady RG was determined by way of NormFinder. Expression data for each gene in an experiment had been transformed from log10 to linear scale utilizing a standard curve and after that loaded into the NormFinder Toreforant Epigenetics Microsoft Excel Add-In1 (54). The most stable gene or mixture of two genes, combined by calculating the geometric imply, was utilized for normalization and is clearly stated within the relevant figures. Target gene expression levels have been expressed as relative expression units (REU), using the highest expressor inside all samples as the calibrator sample.MECHANICAL LOADINGYP_003708382.1 Rev ?TCAGGCCCCTCAGTCCTCACincluded for all reactions. Thermocycling incorporated 1 cycle of 95 for three min, 40 cycles of 95 for 20 s, 60 for 40 s, 72 for 20 s, and 1 cycle of 72 for 10 min. Specificity of RT-qPCR was confirmed by melting curve analysis (Stratagene MX3000P) with complementary deoxyribonucleic acid (cDNA) standard curves of 90?110 efficiency and with an R 2 value of 0.99 accepted.
