Sion levels right after reperfusion were calculated as the percentage with the basal levels before graft harvesting.2004 Lippincott Williams WilkinsSurgical Process and Experimental DesignThe experiment was carried out in two groups of rats: control group (n 44) and FK 409 remedy group (n 40). A rat model of nonarterialized orthotopic liver transplantation without having veno-venous bypass was used as described previously.1 The lobe ligation method was employed to decrease the graft size around the backtable. The median lobe of your liver was chosen to be the graft and also the median ratio on the graft weight to recipient liver weight (graft weight ratio) was 39 (variety 36 46). The graft was stored in cold saline having a target cold ischemic time of 80 minutes. In the FK 409 therapy group, 2 mg/kg FK 409 (kind present from Fujisawa Pharmaceutical Co., Ltd., Japan) in 1 mL of saline was provided intravenously 30 minutes just before graft harvesting in the donors, and 1 mg/kg FK 409 in 1 mL of saline was given immediately after liver transplantation in the CD40 Ligand/CD154 Proteins Recombinant Proteins recipients. The exact same level of saline was provided within the handle group in the similar time points.Survival StudyTen rats in the FK group and 14 rats in the handle group had been made use of for survival study. Rats that had lived for far more than 7 days following transplantation were thought of survivors.Hemodynamic StudySix rats in every group were made use of for hemodynamic study. Following induction of anesthesia, the correct jugular vein of the recipient was cannulated with the tip of a catheter positioned in the entrance on the right atrium for monitoring on the central venous stress. The left femoral artery and ileocolic vein were cannulated by a catheter for measurement with the mean arterial stress and portal stress, respectively. All catheters had been connected via the pressure transducers (MLT1050 Blood Stress, PowerLab Method, ADInstruments Pty Ltd., Australia) and Quad Bridge Amp (ML118 Quad Bridge Amp, PowerLab Method, ADInstruments Pty Ltd.) to aAnnals of Surgery Volume 240, Quantity 1, JulyFK409 Attenuates Small Liver Graft InjuryTABLE 1. Probes and Primer Pairs for Intragraft Gene Detection Employing Quantitative Reverse-Transcription Polymerase Chain Reaction Gene Egr-1 ET-1 ETA HO-1 A20 CXCR2 IP-10 CXCR3 MIP-2 Probe (FAM) TGTGACACACCTTGCCGATGG AGACCCCGCAGGTCCAA CCCTGCCTAGCAATGGCTCAATGC TGCCCCGCTCTACTTCCCTGAGG TTTAAAACCATGCACCGATACACGCTGG ACCTGCTCTGTCACCG ACGAGGCAGAGAAC TTGCCTAGCAGCCC CCCAGACAGAAGTCA Primer pairs Sense: AGTTTCACGTCTTGGTGCCTTT Anti-sense: CCCTCACGATTGCACATGTC Sense: TGATGTCCAGGTGGCAGAAGT Anti-sense: TGCTCCTGCTCCTCCTTGATGGACAAG Sense: CCTTCGACCCCCTAATTTG Anti-sense: CCACCATTCCCACGATGAA Sense: CGAAACAAGCAGAACCCAGTCT Anti-sense: AGCCCTTCGGTGCAGCT Sense: AACCTACCAATGGGATCATCTATCA Anti-sense: GGCAAAACTGGCATGTTCTGA Sense: TGCTGGTCATCTTGTACAATCGA Anti-sense: GGCCAGGTTCAGCAGGTAGAC Sense: GAAGCACCATGAACCCAAGTG Anti-sense: GCGAGAGGGATCCCTTGAGT Sense: CAGTCCTCTACAGCCTCCTCTTTT Anti-sense: TGCGCTGGCTCAGTAGCA Sense: AGAACATCCAGAGCTTGAGTGTGA Anti-sense: TTTTGACCGCCCTTGAGAGTIntragraft Protein Levels of Egr-1, A20, HO-1, and MIP-2 by Western BlotNuclear protein was extracted as described previously for detection of Egr-1 expression. Total protein was applied for A20, HO-1 and MIP-2 detection. The protein samples had been BTLA/CD272 Proteins manufacturer separated in ten sodium dodecyl sulfate-polyacrylamide gel and electrophoretically transferred to polyvinylidene fluoride membrane (Amersham, Buckinghamshire, UK) applying the BioRad electrotransfer system (Bio-Rad Laboratories, Mun.
