Omyelocytic leukemia) cells infected with miR-223. When NB4 cells had been induced with retinoic acid to differentiation, miR-223 was drastically up-regulated, but IGF-1R down regulated, which recommended that IGF-1R acted as the target. In hepatoma cells (SMMC-7721, BEL7404, or Huh-7) IGF-1R also served as the prevalent target when miR-223 inhibited the cell development. In summary (Fig. 9), we established a miR-223 overexpression model by using lentivirus delivery technique and observed that miR223 suppressed the proliferation of tumor cells each in vivo and in vitro. It was through IGF-1R and its downstream signal pathway that miR-223 suppressed the cell growth.Materials and Approaches Plasmid constructionTo construct the lentivirus vector pLL three.7-miR-223 which expressed miR-223, a fragment encoding the pre-miR-Figure 9. Summary of miR-223 inhibiting tumor development by targeting IGF-1R and suppressing the downstream Akt/mTOR/p70S6K signal pathway. The arrow indicated the major results of up-regulation and down-regulation. doi:ten.1371/journal.pone.0027008.gPLoS 1 | plosone.orgMiR-223 Targets IGF-1Rsequence plus 110bp at each 59- and 39-flanking regions (chrX:65238602-65238931, from UCSC web site) was amplified together with the primers 59CCGGTTAACCTGGCAGTCCATTCGTCA39and 59CCGCTCGAGCCTCTAGGGTCACATCTCC39 by PCR from NB4 cell genomic DNA then cloned into the Hpa I/Xho l web sites of pLL 3.7 vector. Psi-CHECKTM-2-IGF-39UTR: The 39 UTR fragment (39untranslated area) of IGF-1R (Genbank ACCESSION: NM_000875) containing the binding web-site (from 1 to 3636 bp inside the 39UTR of IGF1R) was amplified by PCR working with the primers 59CCCCCTCGAGGATCCTGAATCTGTGCAAAC and 39AAAAGCGGCCGCCTTCCCAGCGAAATCATC 39 and cloned into Xho I/Not I web-sites of psi-CHECKTM-2. This vector permitted simultaneous expression of renilla and firefly luciferases. The IGF-1R 39UTR was cloned downstream in the renilla luciferase gene permitting the expression of a renilla transcript with the 39UTR from IGF-1R. Renilla luciferase activity was then utilised to assess the effect on the 39UTR on transcript stability and translation efficiency. The second reporter, firefly luciferase serves as handle. Psi-CHECKTM-2-IGF-39UTR-mut: 3 nucleotides of 39UTR of IGF-1R inside the perfect binding internet site with miR-223 seed sequence, was mutated at the position of 226-228, from AACTGAC to AAgacAC by PCR mutagenesis applying the following primers 59 AAACCCTTAAGACACATGGGCCT 39 and 59 AAGGCCCATGTGTCTTAAGGGTT 39. Thriving mutations had been confirmed by DNA sequencing. PSilencer 4.1 CMV puro-IGF-1R-sh: To silence IGF-1R expression, we constructed a vector-based IGF-1R-shRNA to interfere the expression of IGF-1R. The oligonucleotides we made use of have been 59GATCCGGCCAGAAATGGAGAATAATTCAAGAGATTATTCTCCATTTCTGGCCTCA39 and 59AGCTTGAGGCCAGAAATGGAGAATAATCTCTTGAATTATTCTCCATTTCTGGCCG39 and have been cloned into the Bam H1 and Hind III web-sites of pSilencer-4.1-CMV puro vector. The building of IGF-1R-shRNA was confirmed by DNA sequencing.WI, USA) as well as the luciferase activities were measured from 20 ml lysate working with the Dual Luciferase reporter assay kit (Promega, Madison, WI, USA) on a Vasopeptidase Inhibitors Reagents illuminometer (Lumat LB 9507, Berthold, Germany). All the data have been obtained by averaging the results from six independent repeats. The mutated Betahistine Histamine Receptor psiCHECKTM-2-IGF-1R 39UTR was also transfected beneath the identical situation, and the miR-223 inhibitor and its handle have been utilised at the final concentration of 50 nM to measure the inhibitory impact of miR-223 on the 39UTR of IGF-1R.Colony formation assayTh.
